cupquakegirl42ovkm3h
cupquakegirl42ovkm3h cupquakegirl42ovkm3h
  • 03-09-2017
  • Mathematics
contestada

Mei bought a box of markers for b dollars, a shoulder bag that cost twice as much as the box of markers and a pen that cost $6 less than the shoulder bag. Write the cost of the pen in terms of b.

Respuesta :

Аноним Аноним
  • 03-09-2017
Box of markers = $ B

Shoulder bag =  Twice as much as the box of markers = $ 2B

Pen = Six less than the shoulder bag = $ (2B - 6)

Hence, the cost of pen is $ (2B - 6).
Answer Link

Otras preguntas

why did russia have revolution in 1917?
Graph the first six terms of a sequence where a1 = -10 and d = 3.
amy wants to carpet a room that is 12 feet by 8 feet. how many square yards of carpet will she need to complete the room?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
how would u form a superlative for the adverb widely
What was religion like in Shang China?
how many cups of water should be mixed with 1/4 cup of vinegar to make the cleaning solution?
an explanation describe if a green pet mates with an orange pet, can they have any orange offspring.
What is the noun in the sentence below? The fish swims quickly. a. Quickly b. Fish c. The d. Swims
Angela has 24 golf balls and 18 golf clubs. She wants to sell packages of balls and paddles bundled together. What is the greatest number of packages she can se