LysWizj1els9e LysWizj1els9e
  • 02-01-2017
  • History
contestada

What are some political causes of the european imperialism in asia?

Respuesta :

crystalaquarius
crystalaquarius crystalaquarius
  • 02-01-2017
Most of the reason Europe was able to imperialize other nations such as Asia and Africa was because of advanced weaponry and being more powerful. During the time Europe felt it was their duty also known as white man's burden to imperialize other nations that they felt were inferior to them.
Answer Link

Otras preguntas

Graph the first six terms of a sequence where a1 = -10 and d = 3.
Complete the sentences with seem, look or sound and use like or as if when necessary. 1) Quick! Emma's an the phone. She... she's calling from a long way away.
This natural landmark was created by the natural forces of erosion. What is its correct name and location?
In which system of government would states function independently of each other?
how to i do 7/16÷(31/2÷1/2)
Can someone explain the equation Q = M C delta T or Q = MCΔT Thanks!
How do I do trebuchet calculations????? Help me please
the reproductive system of a male mammal provides
The Earth has four main seasons: winter, spring, summer, and fall. Which of the following is a cause of seasonal changes on Earth? The Earth rotates. The
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5