wapaa wapaa
  • 03-06-2021
  • Biology
contestada

Which of these groups is made up entirely of consumers

Respuesta :

jsalgado2115 jsalgado2115
  • 04-06-2021

Answer:

c

Explanation:

Answer Link

Otras preguntas

Now that you have worked through a lot of material that includes these basic patterns, and you have compared grammatically correct and incorrect sentences, writ
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
TRUE OR FALSE HELP QUICK
Find the missing length indicated
Tyra makes $21.40 per hour at her job for the first 40 hours and $32.10 for anything over 40 hours. if tyra typically works 45 hours per week, how much does she
NEED HELP PLEASE WORTH 15 POINTS Which equation would best help solve the following problem? The height of a triangle is 4 m less than its base. The area of the
BC is parallel to DE What is AC? Enter your answer in the box.
describe five ways to set strategy for effectively gathering patients information
When reading for subject content, prereading activities are not important. Please select the best answer from the choices provided True or False
A hexahedron is a prism whose base is a _____. A. equilateral triangle B. square C. circle D. triangle