pariso82 pariso82
  • 03-05-2021
  • Biology
contestada

Template Strand - A-T-G-C-A-T-G-T-C-A-C-C
T-A-C-G-T-C-A-G-T-G-G|
2. You just wrote in the template strand of DNA. Use the template strand to transcribe a strand
of mRNA
mRNA

Respuesta :

clarareina04 clarareina04
  • 03-05-2021

Answer:

UACGUACUGGAUGCAGUCACC

Explanation:

Answer Link

Otras preguntas

Read the excerpt from the land part one which characters being directly characterized in this excerpt
How did Jonathan protect his bike during the civil war?
What should go in the blank? ^38 19K —> _____ + ^0 -1β A: ^38 18Ar B: ^38 20Ca C: ^39 20Ca D: ^39 19K
What is the name of the guy who produces for Dr. Dre?
Describe 2 ways in which a giant boulder by the ocean may change over time.
How many people are in a Sexteto? A. 2 B. 3 C. 8 D. 10 E. 6
Sending the police inside will only make the hostage situation more O VOLATILE FUNDAMENTAL CLIP O EQUILIBRIUM Help asap
Which number produces an irrational number when multiplied by 1/3 0.166 -/17 2 2/3
Given f (x) = 6x + 100. Find f(-7) =?
Solve the system by substitution. 12x + 6y + 72 = -35 7x - 5y – 6z= 200 x+y= -10