calebakacj calebakacj

02-04-2021
History

contestada

South pass helped pioneers travel over what geographical obstacle?
a. The Great Lakes
b. The Grand Canyon
c. The Rocky Mountains
d. The Mississippi River

Respuesta :

rileyjocrubaugh rileyjocrubaugh

03-04-2021

C) the Rocky Mountains

Answer Link

Otras preguntas

helppp pleaseeeeeeeee

John Hedrick wants to pay one-half of the college costs for his daughter Ruth. She will be attending a private college with annual costs of $20,000 today. Ruth

What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA

what is 3x10+2x1+6x100+4x1000

Seth and Beth have original investments of $50,000 and $100,000, respectively, in a partnership. The articles of partnership include the following provisions re

What is the mean of the data set? 17, 24, 26, 13 ооо

Which of the following is a layer of the solid Earth? A convecting mantle B. biosphere C. Ring of Fire D. atmosphere

The measure of an angle is twenty-nine times the measure of its complementary angle. What is the measure of each angle?

Was texas ever its own country?

The volume of a right circular cone that has a height of 13 m and a base with a diameter of 3.4 m. Round your answer to the nearest tenth of a cubic meter.