briosKmilyautreats
briosKmilyautreats briosKmilyautreats
  • 02-10-2016
  • Mathematics
contestada

what is 83 x 96 fzoigjwcsvgfmcgksjkvzmclkm

Respuesta :

jalize16 jalize16
  • 02-10-2016
7968 because you multiply the two numbers to get the final answer
Answer Link

Otras preguntas

4x-2y=14 y=1/2x-1 Solve the system of linear equations by substitution. Check your answer.
Ms Graves gave her class 12 minutes to read. Carrie read 5/1/2 pages in that time. At what rate, in the pages per hour, did Carrie read?
Gina rented shoes, bowled 3 games, and bought 1 order of nachos. she used a coupon for 1/2 off the price of her bowling games. What was Ginas total cost before
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
A shelf at a bookstore displays 27 books. Of these 27 books, 9 of the books are nonfiction books. The store owner adds 6 new fiction books to the shelf and want
Please help solve, thanks in advance!
Why did the American public mostly oppose joining the League of Nations after WWI?
Please help with Algebra 1
The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the new rectangle in terms of x? Show y
according to the United States constitution the president has the power to (A) negotiate treaties (B) amend the constitution (C) impeach members of congress