jermainolivarez35 jermainolivarez35

02-09-2019
History

contestada

How can the foreign policy agenda of the U.S. be denied after the Monroe Doctrine speech? A. Nationalistic B. Imperialistic C. Neutral D. Isolated

Respuesta :

apatterson8242 apatterson8242

02-09-2019

Answer:

C NETURAL

Explanation:

The purpose of the Monroe Doctrine was to declare the United States and any other North American countries neutral and safe from Europe's colinization.

Answer Link

Otras preguntas

Pls help Thank you ❤️

Someone plz help me :(

please help i’ll give brainlist :)

When was the White House created? need every detail

5. The was founded by Sir Robert Peel in 1829. * O a. New York Police Department O b. Boston Police Department c. Paris Metropolitan Police O d. London Metropol

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

participants in an experiment are said to be blind if they are uninformed about

joey is allowed $10 worth of music each month. This month he has spent within $3 of his allowance

PLEASE HELP ME this is really hard and I need this to bring my grade up

How are Judaism, Christianity, and Islam similar? A. Each religion worships only one god. (monotheistic)B. Each religion is found only in Southern Europe.C. Eac