bignehe bignehe

01-09-2018
Mathematics

contestada

what is the name of a survey that includes all members of a population being studied

Respuesta :

runawaynen16 runawaynen16

01-09-2018

that would be a census!

Answer Link

Otras preguntas

the mammalian heart has: a. 4 chambers b. 2 chambers c. a two-sided muscular pump d. four-sided muscular pump e. a and c f. b and d

Does the increase in blood glucose levels increase the viscosity of the blood

Which quotation from the text best supports the inference that the people of the sac nation do not typically challenge authority? "if he declared war he must le

Which type of oscillation would most likely produce an electromagnetic wave?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

what does the liver do in the excretory system

Which is a characteristic of cancer cells? predictable, uniform cell division evidence of cellular cohesiveness uniform size and shape poor differentiation?

Exponential Equation WITHOUT CALCULATOR

Which statement best describes Washington’s economy in the decades following World War II? A. Economic activity flattened and stagnated. B. Economic activity i

what is the sum of odd positive integers less than 50